فلاش حول تضاعف الadn - منتديات متوسطة هيباوي
  التسجيل   التعليمـــات   التقويم   البحث   مشاركات اليوم   اجعل كافة الأقسام مقروءة



 
 
 
 
 
 
 
 
 
 



إضافة رد
 
أدوات الموضوع انواع عرض الموضوع
افتراضي  فلاش حول تضاعف الadn
كُتبَ بتاريخ: [ 10-17-2010 - 01:14 AM ]
رقم المشاركة : ( 1 )
 
هيباوي
هيباوي غير متواجد حالياً
 
رقم العضوية : 1
تاريخ التسجيل : Feb 2010
مكان الإقامة : منتديات متوسطة هيباوي
عدد المشاركات : 9,545
عدد النقاط : 17
قوة التقييم : هيباوي is on a distinguished road




السلام عليكم

فلاش حول الية تضاعف الadn من الرابط



http://www.biomultimedia.net/archiv/pcr/pcr.htm

للإرتقاء بمنتديات هيباوي ساهم معنا فى نشر الموضوع على الفيس بوك من هنا

رد مع اقتباس
كُتبَ بتاريخ : [ 10-17-2010 - 01:15 AM ]
 
 رقم المشاركة : ( 2 )
هيباوي
رقم العضوية : 1
تاريخ التسجيل : Feb 2010
مكان الإقامة : منتديات متوسطة هيباوي
عدد المشاركات : 9,545
عدد النقاط : 17

هيباوي غير متواجد حالياً




رد مع اقتباس
كُتبَ بتاريخ : [ 10-17-2010 - 01:17 AM ]
 
 رقم المشاركة : ( 3 )
هيباوي
رقم العضوية : 1
تاريخ التسجيل : Feb 2010
مكان الإقامة : منتديات متوسطة هيباوي
عدد المشاركات : 9,545
عدد النقاط : 17

هيباوي غير متواجد حالياً



تمرين1
أختبر معارفي: - نقل الخبر الوراثي من الخلية الأم إلى الخلية البنت-
أعطي تعريف دقيق للمفاهيم التالية: الصبغين............ الصبغي.................... الصيغة الصبغية...................... الهستون...........
النكليوتيد............الدورة الخلوية............الصفيحة الاستوائية..............
أبحث عن المفاهيم الناقصة لإتمام النص التالي:
يحتوي نواة الخلية خلال طور السكون على............... تشكل مادة ............ كل خييط يظهر على شكل.............وهو مكون من.........و.........
.خلال المرحلة S من نفس الطور يخضع..... ل..............حيث ينفصل............ ويتم ......................:نتحدث عن الآلية .....................
التي تضمن الحصول على...............تدخل الخلية بعد ذلك في ..............الذي يتم عبر ............. وهي.........................
خلال هذه المراحل يخضع الخييط ل..............بهدف ضمان عدم إتلاف... أثناء................... نحصل على.................... ..............
لتدخل الخلية البنت في فترة................جديدة.
- تعبير الخبر الوراثي –
أعطي تعريف للمصطلحات التالية:
الطفرة............المورثة............الحليل....... .....المظهر الخارجي..............النمط الوراثي..........البروتين............الاستنساخ.... ......الترجمة.........الجسيم الريبي............ARNt........
ARNm..........الوحدة الرمزية..........مضاد الوحدة الرمزية...........الحمض الأميني.............البداية............الاستطالة.. ...........النهاية............الرمز الوراثي.............
أتمم النص التالي:
يتجلى دور المورثة في........................... هذا الأخير يشكل......................على المستوى الجزيئي ,يتحدد نوع البروتين
من خلال تسلسل.......................... هذا التسلسل مرتبط بتسلسل..........................على مستوى.......................
نتحدث عن....................يتجلى نشاط المورثة في .................... هذا النشاط يتم عبر مرحلة...................
التي تتم في.............بفضل............حيث................ ثم مرحلة................التي تتم............بفضل.............حيث............... ......
نحصل على.............في حالة حدوث..............على مستوى.............سنحصل على..............وبالتالي يتغير.................
الجواب البداية
تمرين2
  1. السؤال الأول : تظهر الوثيقة التالية خلية جدر الثوم ملاحظة بالمجهر خلال مرحلة من مراحل الدورة الخلوية:
    • عرف الدورة الخلوية وأنجز رسم تخطيطي لها.
    • بين معللا جوابك المرحلة المناسبة للصورة.
    • سمي المظهر المميز للصبغيات في الصورة.
    • اعطي الصيغة الصبغية لهذه الخلية مع التعليل.
    • أنجز رسم تخطيطي للمرحلة الموالية مع اعتبارالخلية 2n = 4
    السؤال الثاني: من خلال عرض مقنع ,مختصر و معزز برسوم تفسيرية و براهين ,بين كيف ينتقل الخبر الوراثي من الخلية الأم إلى الخلية البنت ( حالة الخلية ذات نوات حقيقية)
  2. تظهر الوثيقة التالية نفس جزء من ADN عند شخصين أحدهما مصاب بمرض جلدي يتجلى في ظهور بقع سمراء في الجلد بفعل تأثير الشمس والأخر سليم:
    '5TGCTACATCCAGAACTGCGGC3'
    '3ACGATGTAGGTCTTGACGCCG5'
    حالة الشخص السليم '5TGCGACATCCAGAACTGCGGC3'
    '3ACGCTGTAGGTCTTGACGCCG5' حالة الشخص المصاب
    إذا علمت أن سبب الإصابة بهذا المرض يكمن في خلل وظيفي وأن الوظائف الخلوية تنتج عن عمل البروتينات , بين لماذا يصنف هذا المرض ضمن الأمراض الوراثية مستعينا بالجدول جانبه.
  3. اتمم النص التالي بربطك لمختلف المصطلحات المقترحة :
    يتضمن الرمز الوراثي 64 ............. كل......... ترمز الى حمض أميني معين. الوحدة الرمزية عبارة
    عن...................كل نيكليوتيد يتكون من 3 مركبات وهي ..........و.............و...............تشكل النيكليوتيدات A-T-C-G –U حروف اللغة الوراثية . عمل المورثة يتجلى في ..........................
    ويتم ذلك عبر مرحلتين.............و..................تتم عملية الاستنساخ في........................حيث
    نحصل على........الذي يتكون من سلسلة من...................ثم الترجمة التي تتم في.....................
    حيث تترجم كل..............إلى...............بفضل ....................يساهم في عملية الترجمة كل من
    ARNt الذي يتميز بثلاثي النيكليوتيد يدعى................ وموقع خاص بتثبيت......................
    نحصل في النهاية عل سلسلة.................التي تشكل المظهر الخارجي على مستوى الجزيئي.
    في حالة عدم قدرتك القيام بعملية الربط راجع الفقرة الخاصة بتعبير الخبر الوراثي – الجانب المعرفي في علوم الحياة والأرض يكتسي أهمية كبيرة لاكن وحده غير كافي
الجواب البداية
تمرين3
الانقسام غير المباشر وسيلة للتوالد عند الخلية خلا لها تمرر الخلية الأم نفس الخبر الوراثي للخلية البنت.
أنت مطالب بمعرفة مراحل هذه الظاهرة والتمييز بين الانقسام عند الخلية النباتية والخلية الحيوانية.
تذكر أن كمية ADN تتطور خلال الدورة الخلوية كما هو مبين في الوثيقة التالية2:
الوثيقة 2
حاول أن تتعرف على مختلف مراحل الدورة الخلوية وأن تركز على تلك المؤثرة في الخبر الوراثي.......................................
لتفسير كيفية الحفاظ على نفس الخبر الوراثي عند الخلية البنت اليك تفسير لنتائج Messelson:
إستنتج ف مبدأ الألية النصف محافظة و بين كيف تساهم في الحفاظ على نفس الخبر الوراثي عند الخلية البنت.
.................................................. ............................
.................................................. ............................
كيف ينعث هذا النمط من التوالد؟.....................................
.................................................. ..........................
علما أن الصبغي هو دعامة الخبر الوراثي بين التطورات الحاصلة في مظهرالصبغي خلال الدورة الخلوية موازاة مع تطور كمية ADN.

تعبير الخبر الوراثي:
الخبر الوراثي يشمل مجموعة من المورثاث ( الجينوم)
يتجلى دور المورثة في تحديد نوع البروتين المركب على مستوى الخلية.
الية تعبير الخبر الوراثي اذن يتجلى في الية تركيب البروتينات.
مراحل عمل المورثة هي:
- الإستنساخ وتتم العملية في النواة.
- الترجمة وتتم العملية في السيتوبلازم.
البروتين يشكل مصدر الصفة الظاهرة (المظهر الخارجي).
مثال:
'5AATTCTCGGAATC3'
'3TTAAGAGCCTTAG5'
اعطي سلسلة النكليوتيدات ل ARNm المناسب :
اعطي سلسلة الأحماض الأمينية المناسبة مستعملا جدول الرمز الوراثي ( أنظر الدرس )
لترجمة هذا الجزء من ARNm تحتاج الى جدول الرمز الوراثي : لكل وحدة رمزية ( ثلاثي النكليوتيد) حمض أميني مناسب
البروتين المركب قد يكون هرمون ،أنزيم، مضادات أجسام ، وسائط مناعتية ، بروتين بنيوي...... حياة الخلية،العضو ،الجسم في أمس الحاجة اليه مما يفسر علاقة ADN بالحياة.
البداية
جواب التمرين1
نقل الخبر الوراثي
التعريف:
الصبغين = مصطلح مرتبط بنواة الخلية خلال طور السكون ويرمز الى مجموع الخييطلت النووية(الصبغيات).كل خييط يظهر على شكل عقد من اللؤلؤ...Collier de perles.

لاحظ مظهر خييطات الصبغين (طور السكون)
الصبغي : أحد مكونات الصبغين وهو مصطلح مرتبط بفترة الانقسام الخلوي له بنية ''عقد من اللؤلؤ'' خلال فترة السكون وبنية ''عصية'' أثناء الانقسام . يتظاعف (صبيغيين) قبل الانقسام ليعود الى وضعه أثناء الانفصالية.
لاحظ بنية الصبغي الاستوائي.

الصيغة الصبغية: تعبر عن عدد الصبغيات وهي ميزة نوعية قد يرمز لها ب 2n أو ب n( أحادية أو ثنائية ).
الهيستون : مكون من مكونات الخييطات النووية وهو عبارة عن بروتين يرتبط به خييط ADN ليعطي مظهر عقد اللؤلؤ للخييط.
النكليوتيد : مركب عضوي يتكون من المواد التالية :قاعدة أزوتية(A-T-C-G) + سكر خماسي الكاربون + حمض فوسفوري . النكليوتيد يشكل الوحدة البنيوية لجزيئة ADN.
الدورة الخلوية : مدة طور السكون + مدة الانقسام غير المباشر.
الصفيحة الاستوائية : مظهر الصبغيات خلال الطور الاستوائي من الانقسام غير المباشر.
المفاهيم الناقصة:
يحتوي نواة الخلية خلال طور السكون على خييطات تشكل مادة الصبغين كل خييط يظهر على شكل عقد من اللؤلؤ وهو مكون من ADN و هيستونات .خلال المرحلة S من نفس الطور يخضع ADN لتضاعف حيث ينفصل الشريطين الأصليين وتتم بلمرة شريط جديدين مكملين للأصليين نتحدث عن الآلية النصف محافظة التي تضمن الحصول على 2Q ADN. تدخل الخلية بعد ذلك في فترة انقسام الذي يتم عبر 4 مراحل وهي: التمهيدية- الاستوائية- الانفصالية و النهائية.خلال هذه المراحل يخضع الخييط لتكدس يهدف الى ضمان عدم اتلاف ADN أثناء التصاعد القطبي للصبغيات . نحصل على خليتين بنتين مطابقتين للأصل لتدخل الخلية البنت في فترة سكون جديدة.
تعبير الخبر الوراثي
الطفرة: تغير على مستوى ADN يصاحبه تغير على مستوى المظهر الخارجي .
المورثة: جزء من ADN يرمز الى صفة وراثية .
الحليل: يعبر عن المحتوى الوراثي للمورثة و يرمز الى مظهر خارجي محدد.
المظهر الخارجي: الصفة الظاهرة بالنسبة لصفة معينة.
النمط الوراثي: المحتوى الحليلي بالنسبة لمورثة معينة.
البروتين: متتالية من الأحماض الأمينية .
الاستنساخ: مرحلة من مراحل تعبير المورثة تتجلى في استنساخ سلسلة ADN والحصول على ARNm
الترجمة: المرحلة الثانية لتعبير المورثة تتجلى في ترجمة ARNm الى متتالية من الأحماض الأمينية.
الجسيم الريبي: عضي من العضيات الخلوية له القدرة على فهم مختلف الوحدات الرمزية فهو المترجم للرمز الوراثي.
ARNt: الحمض الريبوزي النووي الناقل أحد العناصر الضرورية لترجمة ARNm الى بروتين يقوم بتجميع ونقل الأحماض الأمينية.
ARNm: الحمض الريبوزي النووي الرسول عبارة عن متتالية من الوحدات الرمزية ويشكل نسخة لإحدى سلسلتيADN.
الوحدة الرمزية: ثلاثي النكليوتيد ويرمز الى حمض أميني معين – الرمز الوراثي يشمل 64 وحدة رمزية –
مضاد الوحدة الرمزية: ثلاثي نكليوتيد يميز مختلف ARNt وهو مكمل لوحدة رمزية محددة .
الحمض الأميني: جزيئة بروتيدية بسيطة تتميز بوظيفتين حمضية و أمينية محمولتين على نفس الكربون.
البداية: يقصد بدلك بداية ترجمة ARNm ينتج ذلك عن قرائة الوحدة البدئية AUG التي بفضلها يصبح الجسيم الريبي (المترجم) وظيفي.
الاستطالة: المرحلة الموالية للترجمة ويقصد بذلك اسطالة السلسلة الببتيدية نتيجة لترجمة تدريحية لمختلف الوحدات الرمزية.
النهاية: توقف الترجمة نتيجة لقرائة احدى الوحدات الرمزية بدون معنى(وحدات قف) حيث يصبح الجسيم الريبي من جديد غير وظيفي.
الرمز الوراثي: يتكون من 64 وحدة رمزية ,كل وحدة ترمز لحمض أميني محدد يتميز الرمز بالتكرار و بكونه عالمي.
النص المطلوب
يتجلى دور المورثة في تركيب البروتين هذا الأخير يشكل المظهر الخارجي يتحدد نوع البروتين من خلال تسلسل الأحماض الأمينية .هذا التسلسل مرتبط بتسلسل النيكليوتيدات على مستوى ADN نتحدث عن الرمز الوراثي يتجلى نشاط المورثة ادن في تركيب البروتين هذا النشاط يتم مرحلة الاستنساخ التي تتم في النواة بواسطة ARNpolymerase حيث نحصل على ARNm ثم مرحلة الترجمة التي تتم في السيتوبلازم بفضل الجسيمات الريبية حيث نحصل على بروتين في حالة حدوث طفر على مستوى ADN سنحصل على بروتين مخالف لسابقه وبالتالي سيتغير المظهر الخارجي للصفة المناسبة.
التمرين البداية
جواب التمرين2
  1. جواب السؤال الأول
    • الدورة الخلوية هي الفترة الزمنية لكل من طور السكون والانقسام غير المباشر( المدة الفاصلة بين انقسامين خلويين متتاليين )
    • لاحظ وضوح الصبغيات و تموضعها على شكل صفيحة استوائية مما يدل على أن المرحلة هي المرحلة الاستوائية.
    • المظهر ينعث بالصفيحة الاستوائية.
    • لاحظ أن لكل صبغي مماثله (ظهور الصبغيات على شكل أزواج) مما يعني أن الخلية ثنائية الصيغة الصبغية نرمز للصيغة اذن ب 2n
    • المرحلة الموالية هي الانفصالية : إظهار زوجين من الصبغيات في حالة تصاعد قطبي دون تمثيل النجيمات لأن الخلية نباتية .
    جواب السؤال الثاني:
    السؤال الثاني : لاحظ أنك هنا مطالب باسترداد منظم لمعرفة تتوفر عليها : هذا النوع من الأسئلة المقالية تحتاج إلى مجموعة من الكفايات.
    أول خطوة تحديد الفكرة الرئيسية بعد قرائة جيدة للموضوع
    على المسودة تسجيل جميع المفاهيم المرتبطة بالموضوع دون التمييز بين المفاهيم الضرورية والغير الضرورية
    العودة الى المسودة للتشطيب على ما هو غير مناسب وترتيب ما هو مناسب الى ما هو رئيسي وما هو ثانوي
    وضع تصميم للعرض حيث يضهر جليا التسلسل المنطقي للمعرفة المرتبطة بالموضوع
    الانجاز.
    في حالة الموضوع المقترح لاحظ أن الفكرة الرئيسية تتمحور حول مظاهر نقل الخبر الوراثي من الخلية الأم الى الخلية البنت
    على المسودة أدون جميع المفاهيم المرتبطة بالخبر الوراثي دون أن أهتم بالجانب التنظيمي ودون البحث عن صياغتها في جمل .
    أمثلة: الصبغيات – الدورة الخلوية- الانقسام – عقد من اللؤلؤ – تضاعف ADN- البروتين – الاستنساخ – الطور الانفصالي – الألية النصف محافظة- التكدس- طور السكون ...................تدوين كل المفاهيم التي أتذكرها مهم بغض النظر عن قيمتها بالنسبة للموضوع
    في مرحلة ثانية أقوم بإقصاء ما هو غير مناسب لاحظ هنا مثلا أن البروتين والاستنساخ مفهومين مرتبطين بتعبير الخبر الوراثي وليس بنقله وبالتالي فهما غير مناسبين هنا يتم إقصائهما.
    المفاهيم المرتبطة بالموضوع تتدرج في سياق المقال بشكل يضمن تسلسلها الموضوعي وبالتالي فوضع تصميم مناسب من العمليات الأساسية دون تجاهل المكان المناسب لمختلف الرسوم التخطيطية المناسبة لدعم المقال.لا تنسى أن التعبير الخطاطي من مميزات المقالات العلمية-
    لضمان التدرج الموضوعي ولجعل الاسترداد المعرفي منظم يمكنك وضع عناوين وعناوين مصغرة……
    عناصر الإجابة بالنسبة للموضوع المقترح:
    يمكن الإشارة في المقدمة إلى أهمية الانقسام غير المباشر في التكاثر الخلوي والى دور الصبغيات في نقل الخبر الوراثي من الخلية الأم إلى الخلايا البنات دون الإشارة إلى الآلية.
    1- تطور كمية ADNخلال الدورة الخلوية: يمكن تمثيل ذلك على شكل بيان
    2- الآلية النصف محافظة لإظهار طريقة الحفاظ على تسلسل النيكليوتيدات الأصلي. يمكن التعبير عن الآلية بواسطة رسوم تخطيطية.
    3- تأثير تضاعف ADN على مظهر الصبغيات : يمكن انجاز رسم لصبغي خلال المرحلة S (قبل التضاعف) ورسم لنفس الصبغي خلال المرحلة G1 (بعد التضاعف) .
    4- مصير الصبيغيات خلال الطور الاستوائي: يمكن انجاز رسم لخلية بعدد صبغيات محدد خلال الطور الانفصالي لإظهار كيفية تصاعد نفس الصبغيات نحو القطبين ومن تم استنتاج خصائص الانقسام غير المباشر.
    في الخاتمة يمكن التركيز على أهمية تضاعف الصبغيات خلال طور السكون وانفصال الصبيغيات خلال الطور الانفصالي في الحصول على خلايا مطابقة للأصل.
  2. المرض ناتج عن خلل وظيفي مما يعني أن الخلل يكمن في نشاط بروتيني ونعلم أن تركيب البروتينات على مستوى الخلية ينتج عن عمل المورثات
    فالمطلوب هنا تحديد جزء من البروتين المرتبط بالصفة المدروسة عند الشخصين وربط الخلل بالخبر الوراثي ( ADN) علما أن كل ما هو مرتبط ب ADN وراثي.
    الاستنساخ: في حالة الشخص السليم سنحصل على ARNm التالي:
    UGCUACAUCCAGAACUGCGGC
    في حالة الشخص المصاب بهذا المرض سيكون ARNm كالتالي:
    AUCCAGAACUGCGGC UGCGAC
    لاحظ أن الوحدة الرمزية الثانية UAC استبدلت بالوحدة GAC سبب ذلك كما لاحظت هو استبدال بعض النكليوتيدات بأخرى على مستوى ADN
    الترجمة : بعد ترجمة ARNm سنحصل على سلسلة الأحماض الأمينية التالية :
    في حالة الشخص السليم: Cys-Tyr-Ile-Glu-Asp-Cys-Gly
    في حالة الشخص المصاب: Cys-A.asp-Ile-Glu-Asp-Cys-Gly
    لاحظ أن الحمض Tyr استبدل بالحمض A.asp وتعلم أن وظيفة البروتين مرتبطة بتسلسل الأحماض الأمينية مما يعني أن البروتين المنتج من طرف الخلايا الجلدية غير وظيفي وسبب ذلك خلل على مستوى ADN وبما أن هذه المادة الوراثية تنتقل من الآباء الى الخلف مما يعني انتقال الخلل الملاحظ : المرض ادن وراثي.
  3. يتضمن الرمز الوراثي 64 وحدة رمزية كل وحدة ترمز إلى حمض أميني معين. الوحدة الرمزية عبارة عن متتالية ثلاثية النكليوتيد. كل نيكليوتيد يتكون من 3 مركبات وهي: السكر ,الحمض الفسفوري وقاعدة غنية بالأزوت.تشكل النكليوتيدات ATCGU حروف اللغة الوراثية.عمل المورثة يتجلى في تحديد تسلسل الأحماض الأمينية ويتم ذلك عبر مرحلتين الاستنساخ والترجمة. يتم الاستنساخ في النواة حيث نحصل على ARNm المكون من متتالية من الوحدات الرمزية ثم الترجمة التي تتم في السيتوبلازم حيث تترجم كل وحدة رمزية إلى حمض أميني بفضل الجسيمات الريبية .يساهم في الترجمة كل من ARNt الذي يتميز بثلاثي النكليوتيد يدعى مضاد الوحدة الرمزية وموقع خاص لتثبيت الحمض الأميني .نحصل في النهاية على سلسلة ببتيدية التي تشكل المظهر الخارجي على المستوى الجزيئي.

رد مع اقتباس
كُتبَ بتاريخ : [ 10-17-2010 - 01:19 AM ]
 
 رقم المشاركة : ( 4 )
هيباوي
رقم العضوية : 1
تاريخ التسجيل : Feb 2010
مكان الإقامة : منتديات متوسطة هيباوي
عدد المشاركات : 9,545
عدد النقاط : 17

هيباوي غير متواجد حالياً



تعتبر ال ADN حاملة للخبر الوراثي الذي الذي يتحكم في ظهور الصفات الوراثية. ويدخل هذا ال ADN في تركيب الخييطات النووية التي تخضع لعدة تغييرات خلال دورة خلوية. إذن فماهي التطورات التي تطرأ على الخييطات النووية طيلة الدورة الخلوية؟

وكيف يمكن الانقسام الغير مباشر من الحفاظ على تبات الخبر الوراثي الذي يظهر الصفات الوراثية الخاصة بالكائن الحي؟


التغيرات التي تطرأ على كل من الخييطات النووية والADN المكونة لها خلال طور السكون:

تتكون الدورة الخلوية من طورين: طور السكون وطور الانقسام غير المباشر. أثناء طور السكون يظهر الصبغين مكون من خييطات متشابكة تحتوي على نتوءات متجمعة إنها الخييطات النووية، وخلال الفترة S من طور السكون تظهر عيون النسخ في الخييطات النووية وذلك نتيجة انفتاح لولبي ال ADN بفعل نظام أنزيمي يعمل على تفكيك الروابط الهيدروجينية بين القواعد الأزوتية . وتبدأ عملة مضاعفة ال ADN، تنطلق هذه العملة بكيفية متزامنة بالنسبة للشريطين معا، تحت تأثير ADN بوليميراز، هذا الأنزيم المسؤول عن استطالة السلسلة النكليوتيدية، فيتم تشييد لولب ADN جديد مقابل كل واحد قديم، ومن خلال تجارب Sthal وTaylor وMeselson قد تبين لنا أن تضاعف ال ADN المكون للخييطات النووية تضاعف نصف محافظ لأننا نحصل على خييطات نووية مضاعفة، كل منهما مكون من خييطان نوويان متشابهان من حيث جزيئة ال ADN أي يشبهان الخييط النووي الأصلي، هذا يعني أن هما يتوفران على نفس الخبر الوراثي.

رسم تخطيطي (انظر الملف المرفق1)

كيف يحافظ الانقسام الغير المباشر على ثبات الخبر الوراثي:

بعد طور السكون تدخل الخييطات النووية المضاعفة في طور الانقسام الغير المباشر الذي يتكون من أربعة مراحل :

المرحلة التمهيدية : وخلالها تبدأ الخييطات النووية في التلولب لتظهر على شكل صبغيات .

المرحلة الاستوائية : أثناء هذه المرحة تتموضع الصبغيات على استواء الخلية وهي قد بلغت أقصى درجة من التلولب.

المرحلة الانفصالية : وهي أهم مرحلة فخلالها ينفصل الصبيغيان المتشابهان- من حيث جزيئة ال ADN- على مستوى الجزيء المركزي ويصعد كل واحد منهما الى قطب من أقطاب الخلية، ويصبح كل صبيغي عبارة عن صبغي، وبالتالي نحصل على مجموعتين من الصبغيات المتشابهة من حيث المحتوى الوراثي.

المرحلة النهائية: تفقد خلالها الصبغيات شكلها المميز لتصبح خييطات نووية من جديد، وتكون كل خلية بنت باقي مكوناتها وذلك حسب نوعها { حيوانية أو نباتية} . فيتم الحصول على خليتين متساويتين فيما يخص عدد الخييطات النووية وكمية ال ADN أي أن الخليتين البنتين متشابهتين من حيث المحتوى الوراثي أي من حيث جزيئة ال ADN.

رسم تخطيطي (انظر الملف المرفق 2)


من خلال الدورة الخلوية يتم الحفاظ على الخبر الوراثي وذلك عبر المراحل التالية :

- أثناء طور السكون في الفترة S تتضاعف الصبغيات .

- أثناء الطور الانفصالي : تنفصل الصبغيات على مستوى الجزيء المركزي و تؤدي الهجرة القطبية للصبغيات الناتجة إلى توزيع متساوي للخبر الوراثي.

وهكذا نحصل على خليتين بنتين متساويتين فيما يخص عدد الصبغيات وكمية ال ADN أي لهما نفس الصفات الوراثية.

ال


img1.JPG (1 من 2) 03-17-2010 06:15 PM


التعديل الأخير تم بواسطة هيباوي ; 10-17-2010 الساعة 01:21 AM

رد مع اقتباس
كُتبَ بتاريخ : [ 10-17-2010 - 02:43 PM ]
 
 رقم المشاركة : ( 5 )
مولاي صادقي
رقم العضوية : 522
تاريخ التسجيل : May 2010
مكان الإقامة : الهبلة تسابيت ادرار
عدد المشاركات : 2,000
عدد النقاط : 20

مولاي صادقي غير متواجد حالياً



مشكوووووور والله يعطيك الف عافيه

توقيع : مولاي صادقي

وما من كــاتب إلا سيفنى … ويبقى الدهر ما كتبت يداه
فلا تكتب بكفك غير شىء … يسرك في القيامه ان تراه


إن الملوك إذا شابت عبيدهم ،،،، في رقهم عتقوهم عتق أحرار
وأنت يا خالقي أولى بنا كرما،،،، قد شبت في الرق فاعتقنا من النار

رد مع اقتباس
كُتبَ بتاريخ : [ 10-18-2010 - 01:23 AM ]
 
 رقم المشاركة : ( 6 )
ألقدس عربية
رقم العضوية : 515
تاريخ التسجيل : May 2010
مكان الإقامة :
عدد المشاركات : 566
عدد النقاط : 10

ألقدس عربية غير متواجد حالياً




توقيع : ألقدس عربية

??????? ?????? ??????

رد مع اقتباس
كُتبَ بتاريخ : [ 10-18-2010 - 01:23 AM ]
 
 رقم المشاركة : ( 7 )
محمد الصغير
رقم العضوية : 106
تاريخ التسجيل : Mar 2010
مكان الإقامة :
عدد المشاركات : 1,251
عدد النقاط : 10

محمد الصغير غير متواجد حالياً




توقيع : محمد الصغير

??????? ?????? ??????

رد مع اقتباس
كُتبَ بتاريخ : [ 10-18-2010 - 01:23 AM ]
 
 رقم المشاركة : ( 8 )
ADRIROUA
رقم العضوية : 214
تاريخ التسجيل : Mar 2010
مكان الإقامة :
عدد المشاركات : 560
عدد النقاط : 10

ADRIROUA غير متواجد حالياً




توقيع : ADRIROUA

??????? ?????? ??????

رد مع اقتباس
كُتبَ بتاريخ : [ 10-18-2010 - 01:27 AM ]
 
 رقم المشاركة : ( 9 )
هيباوي
رقم العضوية : 1
تاريخ التسجيل : Feb 2010
مكان الإقامة : منتديات متوسطة هيباوي
عدد المشاركات : 9,545
عدد النقاط : 17

هيباوي غير متواجد حالياً




رد مع اقتباس
كُتبَ بتاريخ : [ 11-05-2010 - 05:06 PM ]
 
 رقم المشاركة : ( 10 )
متوسطة الغمارة
رقم العضوية : 484
تاريخ التسجيل : May 2010
مكان الإقامة :
عدد المشاركات : 679
عدد النقاط : 10

متوسطة الغمارة غير متواجد حالياً




توقيع : متوسطة الغمارة

??????? ?????? ??????

رد مع اقتباس
إضافة رد

مواقع النشر (المفضلة)


الذين يشاهدون محتوى الموضوع الآن : 1 ( الأعضاء 0 والزوار 1)
 
أدوات الموضوع
انواع عرض الموضوع

تعليمات المشاركة
لا تستطيع إضافة مواضيع جديدة
لا تستطيع الرد على المواضيع
لا تستطيع إرفاق ملفات
لا تستطيع تعديل مشاركاتك

BB code is متاحة
كود [IMG] متاحة
كود HTML معطلة


المواضيع المتشابهه
الموضوع كاتب الموضوع المنتدى مشاركات آخر مشاركة
فلاش Calendar هيباوي English Forum 8 02-21-2011 12:20 PM
فلاش Groundhog هيباوي English Forum 8 02-21-2011 12:20 PM
فلاش Clover هيباوي English Forum 7 02-21-2011 12:20 PM
فلاش المغانط هيباوي التكنولوجيا 13 11-21-2010 09:29 PM


الساعة الآن 06:05 AM